DNA homicide fingerprinting case
LAB: INTRODUCTION TO DNA FINGERPRINTING
Half of your 46 chromosomes were inherited from your mother and the other half from your father. Consequently, everyone has a unique DNA pattern (except for identical twins). Tissue samples containing DNA can be used for identification in criminal cases, paternity suits, and in cases where visual identification is not possible. The technique used to make these genetic comparisons is referred to as DNA fingerprinting.
DNA for examination is isolated with a process similar to the method you used in the DNA spooling laboratory. As you know, DNA is located in the nucleus of all body cells. Therefore, DNA can be extracted from any tissue. Common sources include white blood cells, hair roots, semen, saliva (which contains epithelial cells), and other body tissues.
Not all of a person’s DNA codes for synthesis of proteins. A substantial percentage has no known function and is referred to as “junk” DNA (see Figure 1). Junk DNA can be found wedged in between the coding regions of all DNA molecules.
Coding
“Junk” DNA
Coding
FIGURE 1. Position Coding and “junk” DNA
The pattern of junk DNA between any given two genes is unique and has the same repeating pattern of nucleotides (for example C A T). The number of times these nucleotides are repeated, however, is highly variable among people.
As you can see in Figure 2, Person A has nine repeating C A T segments, while person B has only five. Some people have dozens of repeats of the same pattern.
CATCATCATCATCATCATCATCATCAT Person A
CATCATCATCATCAT Person B
FIGURE 2. Repeating junk DNA Segments
Each person has a distinct DNA profile (or “fingerprint”). The process used to create a DNA profile is called RFLP Analysis. RFLP stands for restriction fragment length polymorphism. DNA extracted from a blood or tissue sample is cut into small pieces- at specific locations using special chemicals called restriction enzymes.
Fragment length polymorphism refers to the fact that the pieces (fragments) of repeating junk DNA are different lengths for different people. To make a reliable “RFLP match,” molecular geneticists use several different areas of junk DNA. When several different regions are compared, the odds against a mistaken match can be more than a billion to one.
RFLP FINGERPRINTS
Fragments of DNA are separated using a process called gel electrophoresis. The gel is a thin sheet of gelatin supported by a glass plate with electrodes attached at both ends. One end of the gel has a positive charge and the other end has a negative charge.
The DNA fragments are attracted to the positive end of the gel plate. Smaller, lighter fragments migrate more easily through the gel and therefore travel farther in a given time period than larger, heavier fragments. The light and heavy fragments form bands across the gel laver.
The DNA bands of interest are marked with special molecular probes. Probes are small pieces of DNA that use the base pairing rule to locate and bind only to the fragments that will be used to form the DNA profile.
The sheet of DNA bands is “photographed” with x-ray film. The only bands visible on the developed film are those that have been labeled with molecular probes. The x-ray pattern of bands is the final DNA profile.
Figure 3 shows four DNA profiles. Two profiles match and two do not match. Matching profiles must have exactly the same banding patterns. The bands have been numbered for reference.
Figure 3. Examples of DNA Profiles
SOLVING A CRIME ACTIVITY
On January 1 at about 2:00 A.M. the police responded to a report of gunshots at the 600block of Knorr Street, Arriving at the scene, the officers found a parked Dodge pickup. In the front seat was a deceased male with several gunshot wounds.
Shoe marks were visible in a large pool of blood outside the truck, but not clearly enough to identify the type of footwear. Homicide detectives have narrowed the field to three suspects.
Suspect A was arrested near the scene wearing black work boots that appear to have dried blood on the soles.
At the home of Suspect B, investigators recovered a pair of tennis shoes that also appear to have dried blood on the soles. Suspect B says she had a severe nosebleed, which might have resulted in blood on her shoes.
Suspect C was the roommate of the deceased. When officers went to the apartment to notify him of the death, Suspect C was packing a suitcase. He was wearing hightop sneakers that appeared to have dried blood on the soles and sides. When questioned about the blood and murder, Suspect C had no comment.
All the samples were tested and identified as human blood. The Homicide detectives have asked the Central Police DNA Laboratory to analyze the blood evidence using RFLP analysis. You are the forensic scientist assigned to the case. Figure 4 shows the DNA profiles from all the blood samples.
1. In the box under the first column in Figure 4 (blood of victim) enter the number 1. This is the first unique DNA profile found.
2. Moving from left to right, examine each column. If the DNA profile does not match any previously examined, enter a new number in the box under the column (2, 3, 4, etc.).
Label matching columns with the number of the profile they match until all the columns have a number beneath them.
Figure 4. DNA Profiles Knorr Street Homicide
I’ve added the first number for you
Our Service Charter
-
Excellent Quality / 100% Plagiarism-Free
We employ a number of measures to ensure top quality essays. The papers go through a system of quality control prior to delivery. We run plagiarism checks on each paper to ensure that they will be 100% plagiarism-free. So, only clean copies hit customers’ emails. We also never resell the papers completed by our writers. So, once it is checked using a plagiarism checker, the paper will be unique. Speaking of the academic writing standards, we will stick to the assignment brief given by the customer and assign the perfect writer. By saying “the perfect writer” we mean the one having an academic degree in the customer’s study field and positive feedback from other customers. -
Free Revisions
We keep the quality bar of all papers high. But in case you need some extra brilliance to the paper, here’s what to do. First of all, you can choose a top writer. It means that we will assign an expert with a degree in your subject. And secondly, you can rely on our editing services. Our editors will revise your papers, checking whether or not they comply with high standards of academic writing. In addition, editing entails adjusting content if it’s off the topic, adding more sources, refining the language style, and making sure the referencing style is followed. -
Confidentiality / 100% No Disclosure
We make sure that clients’ personal data remains confidential and is not exploited for any purposes beyond those related to our services. We only ask you to provide us with the information that is required to produce the paper according to your writing needs. Please note that the payment info is protected as well. Feel free to refer to the support team for more information about our payment methods. The fact that you used our service is kept secret due to the advanced security standards. So, you can be sure that no one will find out that you got a paper from our writing service. -
Money Back Guarantee
If the writer doesn’t address all the questions on your assignment brief or the delivered paper appears to be off the topic, you can ask for a refund. Or, if it is applicable, you can opt in for free revision within 14-30 days, depending on your paper’s length. The revision or refund request should be sent within 14 days after delivery. The customer gets 100% money-back in case they haven't downloaded the paper. All approved refunds will be returned to the customer’s credit card or Bonus Balance in a form of store credit. Take a note that we will send an extra compensation if the customers goes with a store credit. -
24/7 Customer Support
We have a support team working 24/7 ready to give your issue concerning the order their immediate attention. If you have any questions about the ordering process, communication with the writer, payment options, feel free to join live chat. Be sure to get a fast response. They can also give you the exact price quote, taking into account the timing, desired academic level of the paper, and the number of pages.